ID: 1111302784

View in Genome Browser
Species Human (GRCh38)
Location 13:86366786-86366808
Sequence CAACATGGCAAGATAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111302784_1111302790 15 Left 1111302784 13:86366786-86366808 CCTGCTTTTATCTTGCCATGTTG No data
Right 1111302790 13:86366824-86366846 GTATCCATCCAGATTGAGGGTGG No data
1111302784_1111302789 12 Left 1111302784 13:86366786-86366808 CCTGCTTTTATCTTGCCATGTTG No data
Right 1111302789 13:86366821-86366843 ATGGTATCCATCCAGATTGAGGG No data
1111302784_1111302788 11 Left 1111302784 13:86366786-86366808 CCTGCTTTTATCTTGCCATGTTG No data
Right 1111302788 13:86366820-86366842 GATGGTATCCATCCAGATTGAGG No data
1111302784_1111302787 -7 Left 1111302784 13:86366786-86366808 CCTGCTTTTATCTTGCCATGTTG No data
Right 1111302787 13:86366802-86366824 CATGTTGGCAGCTGATTAGATGG 0: 12
1: 227
2: 380
3: 665
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111302784 Original CRISPR CAACATGGCAAGATAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr