ID: 1111302786

View in Genome Browser
Species Human (GRCh38)
Location 13:86366801-86366823
Sequence CATCTAATCAGCTGCCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2110
Summary {0: 15, 1: 284, 2: 501, 3: 616, 4: 694}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111302786_1111302788 -4 Left 1111302786 13:86366801-86366823 CCATGTTGGCAGCTGATTAGATG 0: 15
1: 284
2: 501
3: 616
4: 694
Right 1111302788 13:86366820-86366842 GATGGTATCCATCCAGATTGAGG No data
1111302786_1111302789 -3 Left 1111302786 13:86366801-86366823 CCATGTTGGCAGCTGATTAGATG 0: 15
1: 284
2: 501
3: 616
4: 694
Right 1111302789 13:86366821-86366843 ATGGTATCCATCCAGATTGAGGG No data
1111302786_1111302790 0 Left 1111302786 13:86366801-86366823 CCATGTTGGCAGCTGATTAGATG 0: 15
1: 284
2: 501
3: 616
4: 694
Right 1111302790 13:86366824-86366846 GTATCCATCCAGATTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111302786 Original CRISPR CATCTAATCAGCTGCCAACA TGG (reversed) Intergenic
Too many off-targets to display for this crispr