ID: 1111302788

View in Genome Browser
Species Human (GRCh38)
Location 13:86366820-86366842
Sequence GATGGTATCCATCCAGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111302784_1111302788 11 Left 1111302784 13:86366786-86366808 CCTGCTTTTATCTTGCCATGTTG No data
Right 1111302788 13:86366820-86366842 GATGGTATCCATCCAGATTGAGG No data
1111302782_1111302788 24 Left 1111302782 13:86366773-86366795 CCACATTCCTCTGCCTGCTTTTA 0: 33
1: 135
2: 250
3: 415
4: 1022
Right 1111302788 13:86366820-86366842 GATGGTATCCATCCAGATTGAGG No data
1111302783_1111302788 17 Left 1111302783 13:86366780-86366802 CCTCTGCCTGCTTTTATCTTGCC No data
Right 1111302788 13:86366820-86366842 GATGGTATCCATCCAGATTGAGG No data
1111302786_1111302788 -4 Left 1111302786 13:86366801-86366823 CCATGTTGGCAGCTGATTAGATG 0: 15
1: 284
2: 501
3: 616
4: 694
Right 1111302788 13:86366820-86366842 GATGGTATCCATCCAGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111302788 Original CRISPR GATGGTATCCATCCAGATTG AGG Intergenic
No off target data available for this crispr