ID: 1111327714 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:86721039-86721061 |
Sequence | CATTGGACACACATGAACCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1111327708_1111327714 | 10 | Left | 1111327708 | 13:86721006-86721028 | CCCACCTATTCTCACTTAAAATA | No data | ||
Right | 1111327714 | 13:86721039-86721061 | CATTGGACACACATGAACCTTGG | No data | ||||
1111327707_1111327714 | 16 | Left | 1111327707 | 13:86721000-86721022 | CCAAATCCCACCTATTCTCACTT | No data | ||
Right | 1111327714 | 13:86721039-86721061 | CATTGGACACACATGAACCTTGG | No data | ||||
1111327712_1111327714 | 6 | Left | 1111327712 | 13:86721010-86721032 | CCTATTCTCACTTAAAATAGGGA | No data | ||
Right | 1111327714 | 13:86721039-86721061 | CATTGGACACACATGAACCTTGG | No data | ||||
1111327709_1111327714 | 9 | Left | 1111327709 | 13:86721007-86721029 | CCACCTATTCTCACTTAAAATAG | No data | ||
Right | 1111327714 | 13:86721039-86721061 | CATTGGACACACATGAACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1111327714 | Original CRISPR | CATTGGACACACATGAACCT TGG | Intergenic | ||
No off target data available for this crispr |