ID: 1111327714

View in Genome Browser
Species Human (GRCh38)
Location 13:86721039-86721061
Sequence CATTGGACACACATGAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111327708_1111327714 10 Left 1111327708 13:86721006-86721028 CCCACCTATTCTCACTTAAAATA No data
Right 1111327714 13:86721039-86721061 CATTGGACACACATGAACCTTGG No data
1111327707_1111327714 16 Left 1111327707 13:86721000-86721022 CCAAATCCCACCTATTCTCACTT No data
Right 1111327714 13:86721039-86721061 CATTGGACACACATGAACCTTGG No data
1111327712_1111327714 6 Left 1111327712 13:86721010-86721032 CCTATTCTCACTTAAAATAGGGA No data
Right 1111327714 13:86721039-86721061 CATTGGACACACATGAACCTTGG No data
1111327709_1111327714 9 Left 1111327709 13:86721007-86721029 CCACCTATTCTCACTTAAAATAG No data
Right 1111327714 13:86721039-86721061 CATTGGACACACATGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111327714 Original CRISPR CATTGGACACACATGAACCT TGG Intergenic
No off target data available for this crispr