ID: 1111328506

View in Genome Browser
Species Human (GRCh38)
Location 13:86731555-86731577
Sequence TAGAATGCTCAGATGTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111328506_1111328507 -10 Left 1111328506 13:86731555-86731577 CCACTTCACATCTGAGCATTCTA No data
Right 1111328507 13:86731568-86731590 GAGCATTCTACAGTAGCCTGAGG No data
1111328506_1111328510 16 Left 1111328506 13:86731555-86731577 CCACTTCACATCTGAGCATTCTA No data
Right 1111328510 13:86731594-86731616 TTGCCTACCATGGCTGATGATGG No data
1111328506_1111328509 6 Left 1111328506 13:86731555-86731577 CCACTTCACATCTGAGCATTCTA No data
Right 1111328509 13:86731584-86731606 CCTGAGGTCTTTGCCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111328506 Original CRISPR TAGAATGCTCAGATGTGAAG TGG (reversed) Intergenic
No off target data available for this crispr