ID: 1111337058

View in Genome Browser
Species Human (GRCh38)
Location 13:86838638-86838660
Sequence CAGCACCCGTGTCAATGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111337058_1111337061 -10 Left 1111337058 13:86838638-86838660 CCCAGGCATTGACACGGGTGCTG No data
Right 1111337061 13:86838651-86838673 ACGGGTGCTGGCTCCCTACAAGG No data
1111337058_1111337062 -4 Left 1111337058 13:86838638-86838660 CCCAGGCATTGACACGGGTGCTG No data
Right 1111337062 13:86838657-86838679 GCTGGCTCCCTACAAGGCTGTGG No data
1111337058_1111337065 6 Left 1111337058 13:86838638-86838660 CCCAGGCATTGACACGGGTGCTG No data
Right 1111337065 13:86838667-86838689 TACAAGGCTGTGGCTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111337058 Original CRISPR CAGCACCCGTGTCAATGCCT GGG (reversed) Intergenic
No off target data available for this crispr