ID: 1111337065

View in Genome Browser
Species Human (GRCh38)
Location 13:86838667-86838689
Sequence TACAAGGCTGTGGCTACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111337058_1111337065 6 Left 1111337058 13:86838638-86838660 CCCAGGCATTGACACGGGTGCTG No data
Right 1111337065 13:86838667-86838689 TACAAGGCTGTGGCTACACCAGG No data
1111337059_1111337065 5 Left 1111337059 13:86838639-86838661 CCAGGCATTGACACGGGTGCTGG No data
Right 1111337065 13:86838667-86838689 TACAAGGCTGTGGCTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111337065 Original CRISPR TACAAGGCTGTGGCTACACC AGG Intergenic
No off target data available for this crispr