ID: 1111337448

View in Genome Browser
Species Human (GRCh38)
Location 13:86841072-86841094
Sequence CAGGAACTTGGTGCTGTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111337442_1111337448 4 Left 1111337442 13:86841045-86841067 CCCTGCACAAAGCCTCTTGTTGA No data
Right 1111337448 13:86841072-86841094 CAGGAACTTGGTGCTGTCGATGG No data
1111337440_1111337448 14 Left 1111337440 13:86841035-86841057 CCCTGGGCAGCCCTGCACAAAGC No data
Right 1111337448 13:86841072-86841094 CAGGAACTTGGTGCTGTCGATGG No data
1111337446_1111337448 -8 Left 1111337446 13:86841057-86841079 CCTCTTGTTGAGGTGCAGGAACT No data
Right 1111337448 13:86841072-86841094 CAGGAACTTGGTGCTGTCGATGG No data
1111337441_1111337448 13 Left 1111337441 13:86841036-86841058 CCTGGGCAGCCCTGCACAAAGCC No data
Right 1111337448 13:86841072-86841094 CAGGAACTTGGTGCTGTCGATGG No data
1111337443_1111337448 3 Left 1111337443 13:86841046-86841068 CCTGCACAAAGCCTCTTGTTGAG No data
Right 1111337448 13:86841072-86841094 CAGGAACTTGGTGCTGTCGATGG No data
1111337439_1111337448 27 Left 1111337439 13:86841022-86841044 CCTAGGGACGCAGCCCTGGGCAG No data
Right 1111337448 13:86841072-86841094 CAGGAACTTGGTGCTGTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111337448 Original CRISPR CAGGAACTTGGTGCTGTCGA TGG Intergenic
No off target data available for this crispr