ID: 1111344701

View in Genome Browser
Species Human (GRCh38)
Location 13:86935721-86935743
Sequence GATCTAACCAGATCAAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 6, 3: 12, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111344699_1111344701 -5 Left 1111344699 13:86935703-86935725 CCACATGACAGGATCCAAGATCT 0: 1
1: 1
2: 1
3: 27
4: 180
Right 1111344701 13:86935721-86935743 GATCTAACCAGATCAAGCTCTGG 0: 1
1: 0
2: 6
3: 12
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111344701 Original CRISPR GATCTAACCAGATCAAGCTC TGG Intergenic
902225964 1:14996628-14996650 GATCTGACAAGATCAGGATCTGG + Intronic
904976779 1:34462596-34462618 GATTTAACCACTTCCAGCTCAGG - Intergenic
909895898 1:81068770-81068792 GATCTAACCAGAGCAGTATCAGG + Intergenic
911161590 1:94687245-94687267 GCTCCAATCAGATCAAGCTCTGG - Intergenic
912826232 1:112906018-112906040 GATCTGGCCAGAGTAAGCTCAGG + Intergenic
914794296 1:150906967-150906989 GATCTAACCAGAGTAAGACCAGG + Intergenic
918515905 1:185362797-185362819 TAACCAACCAGAACAAGCTCTGG + Intergenic
922907553 1:229185896-229185918 GATCCAATCAGATGGAGCTCCGG + Intergenic
924334457 1:242973349-242973371 GGTCTACTTAGATCAAGCTCTGG + Intergenic
1065405871 10:25363684-25363706 GATTCAACCAGATTGAGCTCTGG - Intronic
1066199908 10:33134702-33134724 GATCCAATCAGATCGAGCCCTGG + Intergenic
1066260290 10:33723398-33723420 GATCCAATCAGATCAAGCCCTGG + Intergenic
1067179986 10:43977900-43977922 GATCAAACCTTATCATGCTCTGG - Intergenic
1067554241 10:47256978-47257000 GATCCAATCAGAGGAAGCTCTGG + Intergenic
1067627149 10:47933098-47933120 CCTCTCACCAGATCAAGCCCTGG - Intergenic
1069375268 10:67786945-67786967 GATCCAATCAGATCAAGCCCTGG + Intergenic
1073519528 10:104114123-104114145 GATTAAACCAGAGCCAGCTCTGG - Intergenic
1078762783 11:14264787-14264809 GATCTAACCTAATTAATCTCTGG + Intronic
1078778753 11:14417487-14417509 GATCTAACAGGATCCACCTCTGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1088257559 11:107915658-107915680 GATCCAATCAGATCAAGCCCTGG + Intronic
1090704029 11:129320559-129320581 TATGAAACCAGATAAAGCTCAGG - Intergenic
1093315530 12:17645854-17645876 GCTCTAACCAGAGTAACCTCTGG - Intergenic
1100420257 12:94425330-94425352 GATCCAATCAGATCAAGCTCTGG + Intronic
1101648558 12:106653931-106653953 GATCTAGCCAGAACAAGGCCAGG + Intronic
1102454418 12:113062971-113062993 GATCTAACATCATCCAGCTCAGG - Intronic
1103185660 12:118954950-118954972 GATCCAATCAGATCGAGCTCTGG - Intergenic
1104423687 12:128657551-128657573 GATCCAATCAGATCGAGCCCTGG - Intronic
1104578392 12:129989619-129989641 GATCTAACCAGTTCAAACCTAGG + Intergenic
1104654877 12:130567079-130567101 GCTCTGACCAGACCAAACTCAGG + Intronic
1105004571 12:132713379-132713401 GATTTCACCAGATGAGGCTCTGG - Intronic
1106171304 13:27290885-27290907 GATCCAATCAGATCAAGCTCTGG - Intergenic
1108374114 13:49797322-49797344 GATCCTATCAGATCAAGCCCAGG + Intergenic
1110041495 13:70765618-70765640 GATCCAATCAGATCGAGCCCTGG - Intergenic
1111344701 13:86935721-86935743 GATCTAACCAGATCAAGCTCTGG + Intergenic
1111926671 13:94470357-94470379 GGACTAATAAGATCAAGCTCTGG + Intronic
1114888123 14:26880742-26880764 AATCCAATCAGATAAAGCTCTGG - Intergenic
1115027219 14:28759359-28759381 TATCTAACAAGTTCACGCTCCGG + Intergenic
1115291357 14:31776526-31776548 GATCCAATCAGATCAAGTCCTGG - Intronic
1115759280 14:36561769-36561791 GAGCTAAAGAGATCAAGATCAGG + Intergenic
1117658786 14:57983308-57983330 GATCCAATCAGATCAAGCCCTGG - Intergenic
1120457056 14:84744990-84745012 GATCTAAACAGATCAATTGCAGG + Intergenic
1121038139 14:90723599-90723621 GAACTAACCAGGTCAAGCACAGG - Intronic
1121262277 14:92575238-92575260 GATATCACCAGAGCAAGGTCAGG + Intronic
1122193516 14:100067320-100067342 TATCTTACCAGCTCTAGCTCTGG + Intronic
1131340886 15:91599519-91599541 GATATTATCAGATAAAGCTCTGG + Intergenic
1139327272 16:66162163-66162185 GATCCAATCAGATCGAGCCCTGG + Intergenic
1153607833 18:6853003-6853025 GATCTAATCAGATTGAGCCCTGG - Intronic
1153846854 18:9057964-9057986 GATCCAATCAGATCTAGCTGTGG + Intergenic
1153846872 18:9058056-9058078 GATCCAATCAGATCTAGCTGTGG + Intergenic
1161877103 19:6920181-6920203 GATCCAATCAGATCAAGACCTGG - Intronic
1166651059 19:44575516-44575538 GAGCCAATCAGATCAAGCCCTGG - Intergenic
926515877 2:13845268-13845290 GATTCAGTCAGATCAAGCTCTGG - Intergenic
927612820 2:24558868-24558890 GATCCAACGAGATCAAGCCCTGG - Intronic
930574525 2:53130022-53130044 GACCTAACCACAACTAGCTCTGG + Intergenic
931683858 2:64775915-64775937 GAGTTATCCAGATCCAGCTCAGG - Intergenic
935239124 2:101163208-101163230 GATCCAATCAGATTGAGCTCTGG + Intronic
935487674 2:103677933-103677955 GTTCCAATCAGATTAAGCTCTGG - Intergenic
936693139 2:114916336-114916358 AATCTAACCAGAAAAAGCCCTGG + Intronic
939025795 2:137012388-137012410 TACCAAAACAGATCAAGCTCAGG - Intronic
942112093 2:172692728-172692750 GATCCAATCAGATCACGCCCTGG - Intergenic
943300505 2:186191737-186191759 GATTAAATCAGATCAAGCCCTGG + Intergenic
1170592469 20:17781320-17781342 GATCCAATCAGATCAAGCTCTGG + Intergenic
1172152696 20:32801528-32801550 GATCTAGCCAGACCAAGAACGGG - Intronic
1177256491 21:18669718-18669740 GACCTAATCAGATTAACCTCTGG - Intergenic
1177961645 21:27674047-27674069 GATCCAATCAGATCAAGCCCTGG - Intergenic
1181358818 22:22319309-22319331 GCTCTGACCAAATCTAGCTCAGG + Intergenic
954901729 3:54025924-54025946 GATCCAATCAGATCGAGCTCTGG - Intergenic
956526163 3:70164501-70164523 GATCTAACCAGAAAAAGTGCAGG - Intergenic
959605835 3:108241364-108241386 GATCCAATCAGATAGAGCTCTGG + Intergenic
961501779 3:127341292-127341314 AAGCCAACCAGGTCAAGCTCTGG + Intergenic
962010980 3:131390563-131390585 AGTCTCACCAGATCAAGATCTGG + Intergenic
970420262 4:15899271-15899293 GATCCAATCAGATCAATCCCTGG - Intergenic
971440908 4:26684382-26684404 GATTCAATCAGATCAAGCCCTGG - Intronic
979242652 4:118461934-118461956 GGTCTACTTAGATCAAGCTCTGG - Intergenic
983103017 4:163649466-163649488 AATTTCACCAGATCAATCTCTGG - Intronic
991517850 5:67459154-67459176 GGTCTAATCAGATTGAGCTCTGG + Intergenic
992029152 5:72703178-72703200 GATTCAATCAGATCAAGCCCTGG + Intergenic
994237412 5:97379504-97379526 GAGCTACCCAGATCACCCTCAGG - Intergenic
999353236 5:150898077-150898099 GATCTATCCAGATGAATATCAGG - Exonic
999543453 5:152600008-152600030 GACCTAATCATACCAAGCTCGGG + Intergenic
1001203719 5:169742632-169742654 AATCTAACCAAAGCAACCTCAGG - Intronic
1001521376 5:172396011-172396033 TATCTCCACAGATCAAGCTCGGG + Intronic
1004202276 6:13560153-13560175 GATCCAATCAGATCAAGCTCTGG + Intergenic
1011613855 6:89180235-89180257 GATGGAACCTGATCTAGCTCTGG - Intronic
1013017779 6:106176751-106176773 GTTCTAACCAAATCTAGTTCAGG + Intergenic
1013337692 6:109181496-109181518 GATCTGACCAGAGGAAGCTCAGG - Intergenic
1019760136 7:2805043-2805065 GATCCAACCTGGTCAAGCTGGGG + Intronic
1019903134 7:4040203-4040225 GATCCAATCAGATTCAGCTCTGG - Intronic
1019949585 7:4360646-4360668 GATCCAATCAGATCAAGCTCTGG - Intergenic
1023910985 7:44556324-44556346 GATCCAATCAGATCAAGCTCTGG - Intergenic
1024307129 7:47938387-47938409 GATCTACCCAGGTCCTGCTCTGG - Intronic
1030890049 7:114988552-114988574 AATCTACCCAGATTTAGCTCTGG - Intronic
1032110747 7:129073167-129073189 GATCCAATCAGATTGAGCTCTGG + Intergenic
1032338258 7:131046278-131046300 AATCCAACCAGATTGAGCTCTGG + Intergenic
1033019443 7:137707839-137707861 GATCTAACAAGATCTTGGTCAGG - Intronic
1033232397 7:139610909-139610931 GATCCAATCAGATCGAGCTGTGG + Intronic
1036953546 8:13163678-13163700 GAGCTAGCTAGATCAAGATCTGG + Intronic
1038156070 8:24991770-24991792 GATCCAATCAGATTGAGCTCTGG - Intergenic
1039823873 8:41156815-41156837 GATCCAATCAGATTGAGCTCTGG + Intergenic
1043235187 8:77855944-77855966 AACCTCAGCAGATCAAGCTCTGG + Intergenic
1044854363 8:96459277-96459299 GATCCAATCAGATCGAGCTCTGG + Intergenic
1046314686 8:112483714-112483736 GAACTAACCTCATCAATCTCAGG + Intronic
1048493219 8:134913654-134913676 GATTCAACCAGAACAAGCCCAGG - Intergenic
1051035790 9:12743601-12743623 GATCAAATCAGATTAATCTCTGG - Intergenic
1053154689 9:35768774-35768796 GATATATCCAGATCCATCTCAGG + Intergenic
1058802266 9:108556081-108556103 GATCGCACTGGATCAAGCTCAGG + Intergenic
1059855566 9:118393418-118393440 GATCTCACTTGATCAAGCTGAGG - Intergenic
1187982739 X:24775969-24775991 GATCCAACCAGATCTGGCTTGGG - Intronic
1197812836 X:130463381-130463403 GATCCAACCAGATTGAGCTATGG + Intergenic
1198844001 X:140889926-140889948 GGTCCAACCAGATTAAACTCTGG + Intergenic
1202390384 Y:24364041-24364063 GGTCTACTTAGATCAAGCTCTGG - Intergenic
1202480400 Y:25306075-25306097 GGTCTACTTAGATCAAGCTCTGG + Intergenic