ID: 1111350850

View in Genome Browser
Species Human (GRCh38)
Location 13:87029161-87029183
Sequence CTGGGATAGTAGCTTCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111350850_1111350854 3 Left 1111350850 13:87029161-87029183 CCTGTATGAAGCTACTATCCCAG No data
Right 1111350854 13:87029187-87029209 TGTGAAAAGTAGACTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111350850 Original CRISPR CTGGGATAGTAGCTTCATAC AGG (reversed) Intergenic
No off target data available for this crispr