ID: 1111351327

View in Genome Browser
Species Human (GRCh38)
Location 13:87035180-87035202
Sequence TCTTTGGTCTACTGGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111351321_1111351327 8 Left 1111351321 13:87035149-87035171 CCAGCATGCACATTTCCATCAGC No data
Right 1111351327 13:87035180-87035202 TCTTTGGTCTACTGGGAGACAGG No data
1111351322_1111351327 -7 Left 1111351322 13:87035164-87035186 CCATCAGCCTCTGTCTTCTTTGG No data
Right 1111351327 13:87035180-87035202 TCTTTGGTCTACTGGGAGACAGG No data
1111351319_1111351327 27 Left 1111351319 13:87035130-87035152 CCCAAGGATATGAGGAATGCCAG No data
Right 1111351327 13:87035180-87035202 TCTTTGGTCTACTGGGAGACAGG No data
1111351320_1111351327 26 Left 1111351320 13:87035131-87035153 CCAAGGATATGAGGAATGCCAGC No data
Right 1111351327 13:87035180-87035202 TCTTTGGTCTACTGGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111351327 Original CRISPR TCTTTGGTCTACTGGGAGAC AGG Intergenic
No off target data available for this crispr