ID: 1111352961

View in Genome Browser
Species Human (GRCh38)
Location 13:87056654-87056676
Sequence CTATTTCAGAGACCATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111352961_1111352962 13 Left 1111352961 13:87056654-87056676 CCAATAAATGGTCTCTGAAATAG No data
Right 1111352962 13:87056690-87056712 GTTTTCTGTAGTTGATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111352961 Original CRISPR CTATTTCAGAGACCATTTAT TGG (reversed) Intergenic
No off target data available for this crispr