ID: 1111358204

View in Genome Browser
Species Human (GRCh38)
Location 13:87139066-87139088
Sequence TCCTACATGCAGATGATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111358204_1111358209 -2 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358209 13:87139087-87139109 GACTGCTCTCTGAGGGGAGGAGG No data
1111358204_1111358206 -9 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358206 13:87139080-87139102 CATGTAGGACTGCTCTCTGAGGG No data
1111358204_1111358211 5 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358211 13:87139094-87139116 CTCTGAGGGGAGGAGGTTGTGGG No data
1111358204_1111358212 6 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358212 13:87139095-87139117 TCTGAGGGGAGGAGGTTGTGGGG No data
1111358204_1111358213 7 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358213 13:87139096-87139118 CTGAGGGGAGGAGGTTGTGGGGG No data
1111358204_1111358210 4 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358210 13:87139093-87139115 TCTCTGAGGGGAGGAGGTTGTGG No data
1111358204_1111358214 8 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358214 13:87139097-87139119 TGAGGGGAGGAGGTTGTGGGGGG No data
1111358204_1111358207 -8 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358207 13:87139081-87139103 ATGTAGGACTGCTCTCTGAGGGG No data
1111358204_1111358208 -5 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358208 13:87139084-87139106 TAGGACTGCTCTCTGAGGGGAGG No data
1111358204_1111358205 -10 Left 1111358204 13:87139066-87139088 CCTTTAATCATCTGCATGTAGGA No data
Right 1111358205 13:87139079-87139101 GCATGTAGGACTGCTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111358204 Original CRISPR TCCTACATGCAGATGATTAA AGG (reversed) Intergenic
No off target data available for this crispr