ID: 1111360169

View in Genome Browser
Species Human (GRCh38)
Location 13:87165760-87165782
Sequence CATGCTTCCTAATAAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111360168_1111360169 8 Left 1111360168 13:87165729-87165751 CCATGATTGTAAGTTTTCTGACA No data
Right 1111360169 13:87165760-87165782 CATGCTTCCTAATAAGCCAGTGG No data
1111360167_1111360169 23 Left 1111360167 13:87165714-87165736 CCTCTTCATCTTCTGCCATGATT 0: 60
1: 983
2: 2146
3: 3882
4: 5522
Right 1111360169 13:87165760-87165782 CATGCTTCCTAATAAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111360169 Original CRISPR CATGCTTCCTAATAAGCCAG TGG Intergenic
No off target data available for this crispr