ID: 1111381167

View in Genome Browser
Species Human (GRCh38)
Location 13:87454703-87454725
Sequence CTCATATGGAAGAAGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111381167_1111381172 9 Left 1111381167 13:87454703-87454725 CCTTGTCCCTTCTTCCATATGAG No data
Right 1111381172 13:87454735-87454757 GAGAAAAGATTCTATGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111381167 Original CRISPR CTCATATGGAAGAAGGGACA AGG (reversed) Intergenic
No off target data available for this crispr