ID: 1111384496

View in Genome Browser
Species Human (GRCh38)
Location 13:87506677-87506699
Sequence AGAAACACATGAGCATATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111384496_1111384498 24 Left 1111384496 13:87506677-87506699 CCTAGATATGCTCATGTGTTTCT No data
Right 1111384498 13:87506724-87506746 TGTTGACGATAGCACTGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111384496 Original CRISPR AGAAACACATGAGCATATCT AGG (reversed) Intergenic
No off target data available for this crispr