ID: 1111386938

View in Genome Browser
Species Human (GRCh38)
Location 13:87539589-87539611
Sequence TAGCCATAGGGGCTACAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111386930_1111386938 26 Left 1111386930 13:87539540-87539562 CCCTGATGAGAAGGCTCAGAAGA No data
Right 1111386938 13:87539589-87539611 TAGCCATAGGGGCTACAAATGGG No data
1111386931_1111386938 25 Left 1111386931 13:87539541-87539563 CCTGATGAGAAGGCTCAGAAGAT No data
Right 1111386938 13:87539589-87539611 TAGCCATAGGGGCTACAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111386938 Original CRISPR TAGCCATAGGGGCTACAAAT GGG Intergenic
No off target data available for this crispr