ID: 1111388639

View in Genome Browser
Species Human (GRCh38)
Location 13:87561889-87561911
Sequence CGGGGTGGCGGCGGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111388639_1111388652 12 Left 1111388639 13:87561889-87561911 CCCTCTGCCCCGCCGCCACCCCG No data
Right 1111388652 13:87561924-87561946 ACCCAACAGCTGATTGAGAACGG No data
1111388639_1111388656 28 Left 1111388639 13:87561889-87561911 CCCTCTGCCCCGCCGCCACCCCG No data
Right 1111388656 13:87561940-87561962 AGAACGGGCCATGATGATGATGG 0: 55
1: 470
2: 986
3: 720
4: 280
1111388639_1111388654 13 Left 1111388639 13:87561889-87561911 CCCTCTGCCCCGCCGCCACCCCG No data
Right 1111388654 13:87561925-87561947 CCCAACAGCTGATTGAGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111388639 Original CRISPR CGGGGTGGCGGCGGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr