ID: 1111395859

View in Genome Browser
Species Human (GRCh38)
Location 13:87670180-87670202
Sequence TGCAATGTATCTACAGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111395858_1111395859 12 Left 1111395858 13:87670145-87670167 CCTTTTGTGGATGACGTGTAAGT 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1111395859 13:87670180-87670202 TGCAATGTATCTACAGCTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111395859 Original CRISPR TGCAATGTATCTACAGCTAG TGG Intergenic
904258522 1:29273020-29273042 TGCAAAGTGTCCCCAGCTAGAGG - Intronic
906293383 1:44634353-44634375 TGCAATCTAGCTTCAGCAAGTGG + Intronic
906837075 1:49095530-49095552 TGCAACATATCTACAACTATCGG + Intronic
907567470 1:55449277-55449299 TGCAAAGTACCTATATCTAGTGG + Intergenic
908089710 1:60673023-60673045 TGCAATGTAGGTACAGTTAATGG - Intergenic
908679925 1:66649127-66649149 TAAAATGTATCTACATCTCGAGG + Intronic
911440639 1:97921356-97921378 AACAATGTATCTACATCTCGCGG - Intergenic
911607349 1:99923178-99923200 TCCAATGTATTTATAGATAGTGG - Exonic
912026536 1:105181784-105181806 TGCAAAGCATCCACAGATAGAGG + Intergenic
914840273 1:151242530-151242552 TGCAAAGTCTCTCCAACTAGAGG - Exonic
916413885 1:164575090-164575112 TGCTATGTATTTGCAGCTATTGG + Intronic
918392921 1:184085020-184085042 TGCAATTTATCTAAACCTAAAGG - Intergenic
918448458 1:184636550-184636572 TGGAATGTATCTACAGCTCCAGG - Intergenic
918711086 1:187731212-187731234 TACACTGTGTCTACAGATAGAGG - Intergenic
923053328 1:230404189-230404211 TGGCATGTATCTAGAGCTTGGGG - Intronic
923158748 1:231299990-231300012 TGCAAAGTGTCTACATCCAGGGG - Intergenic
1072290419 10:93959931-93959953 TGCAAAGTCTCTTCAACTAGAGG + Intergenic
1085791835 11:79503221-79503243 TGCAATGGCTCTGCAGCCAGCGG - Intergenic
1086209386 11:84300251-84300273 TGCAAACTGTCTACAGATAGAGG + Intronic
1086449296 11:86900226-86900248 TGCAAAGTGTCTACAATTAGAGG - Intronic
1093125961 12:15328911-15328933 TGCAATTTATCTACAAGTAGTGG + Intronic
1099701547 12:86089318-86089340 TTCAATGTATTAACAGATAGAGG - Intronic
1108038584 13:46318043-46318065 ATCCATGTATCTACAGCCAGTGG + Intergenic
1111395859 13:87670180-87670202 TGCAATGTATCTACAGCTAGTGG + Intergenic
1116305126 14:43243843-43243865 AGCAATGTAGATGCAGCTAGAGG - Intergenic
1120404290 14:84074882-84074904 TGCATTGTATTTACATCCAGAGG + Intergenic
1120853010 14:89187724-89187746 AGGAATGTATCTGCAGCTTGTGG - Intronic
1127682377 15:61310292-61310314 AGCAATGTATATGCAGCTGGAGG - Intergenic
1128834235 15:70796336-70796358 TCAAATGTATCTACAGCCACAGG - Intergenic
1130732583 15:86513588-86513610 AGCAATGTAGCTAAAGTTAGTGG - Intronic
1134162886 16:11906235-11906257 TGCAATGAATGTACAGATGGAGG - Intronic
1136389308 16:29952351-29952373 TGCCATGCAGCTACTGCTAGGGG + Intronic
1137902722 16:52286703-52286725 AGCAATGTAGATACAGCTGGAGG + Intergenic
1138780445 16:59778789-59778811 TTCAGTGTATCTGTAGCTAGAGG + Intergenic
1143316433 17:6036780-6036802 TTCAGTGTATCTCCAGCTGGAGG - Intronic
1143541243 17:7570686-7570708 TGCCAAGTATCTACAGGCAGAGG + Exonic
1146262874 17:31433210-31433232 TGCATTCTCTCTGCAGCTAGTGG - Intronic
1148769981 17:50061037-50061059 TCCAATGGGTCTACAGCCAGAGG - Intronic
1150993984 17:70294995-70295017 TGCAATGTATTTAGGACTAGGGG - Intergenic
1157210248 18:45735922-45735944 TGCAATTTATCAACAGCTCAAGG + Intronic
1157755684 18:50215348-50215370 TGCTCTGTATCTTCAGCTGGTGG + Intergenic
1160161396 18:76474035-76474057 TGTAATATAACTACAGCTGGGGG - Intronic
1165032777 19:33010257-33010279 TTCAATGTTTCTACAGCTGATGG - Intronic
926932298 2:18052757-18052779 TGCAGTGTTTCTACAGCAAGAGG - Intronic
929277179 2:40038640-40038662 AGCCATCTATCTCCAGCTAGGGG + Intergenic
941351851 2:164447767-164447789 AGCAAGGAACCTACAGCTAGAGG + Intergenic
941612842 2:167682743-167682765 TGCAAGGAATTTACAGCAAGGGG - Intergenic
942511928 2:176711652-176711674 TGCAATTTATCTTAAGATAGAGG + Intergenic
1169580513 20:7018012-7018034 TGCAATGTTTCCAGTGCTAGAGG + Intergenic
1170018334 20:11808287-11808309 TGCAAAGTAACCACAGCAAGTGG - Intergenic
1170149580 20:13215724-13215746 TGCATTCTCTGTACAGCTAGGGG + Intergenic
1170746679 20:19105795-19105817 TGCAATGTACCAACAGCTAATGG + Intergenic
951269257 3:20604579-20604601 TGGAATGTATGTCCAGATAGAGG + Intergenic
957518689 3:81290596-81290618 TGGAATTTATCTTCAGCTACAGG - Intergenic
965482839 3:169241503-169241525 TGGAATGTACCTTAAGCTAGGGG + Intronic
965562776 3:170077779-170077801 TGCAGTGTAACAGCAGCTAGTGG - Intronic
965986804 3:174763672-174763694 TGCAATGTATCTAGTGTTAATGG + Intronic
980219699 4:129899844-129899866 TGCAGTGTAACAGCAGCTAGGGG + Intergenic
987506598 5:18782425-18782447 TGCAATGTAAGAGCAGCTAGGGG + Intergenic
987701806 5:21409553-21409575 TGCAATGTAAGAGCAGCTAGGGG + Intergenic
991369002 5:65898582-65898604 TGCAATGTTTCTACAAGGAGAGG - Intergenic
995552274 5:113293461-113293483 TGCTTAGTGTCTACAGCTAGAGG - Intronic
996586539 5:125094119-125094141 TCCATTGTACCTAGAGCTAGAGG + Intergenic
997991609 5:138549123-138549145 TGCAATGTACCTACATATAAGGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
1007675544 6:43591091-43591113 TGCAAAGTATGTCAAGCTAGAGG + Intronic
1007705658 6:43789553-43789575 TTCAATGTATCTCCAGCTCCTGG + Intergenic
1012797574 6:103782022-103782044 TGCCATGTATCAACAGCCAGGGG + Intergenic
1013701725 6:112779141-112779163 TTCAATTTATTCACAGCTAGTGG + Intergenic
1015530100 6:134213184-134213206 TGCAAAGTACCTAAAGCTATAGG - Intronic
1017549071 6:155484777-155484799 TGTAATGAATCTTCAGTTAGTGG - Intergenic
1018791168 6:167148986-167149008 AGCAATGCATCTACAGATATGGG - Intronic
1032985932 7:137337212-137337234 TCCAATGTATGTACAGTTAGAGG - Intronic
1035063040 7:156083295-156083317 TGCAATGTACCTTTAGCTAAGGG + Intergenic
1035411797 7:158649974-158649996 TTCAATTCATCTACAGCTACCGG + Intronic
1035900974 8:3458193-3458215 TGCAATGTAGCTGGAGCTAACGG + Intronic
1041028831 8:53715234-53715256 TGCCATGTATGTACTGCTAAAGG + Intergenic
1042814916 8:72867865-72867887 TGGAATCTATCTACAGCGAGTGG - Intronic
1046547665 8:115671708-115671730 TGTAATGTATCTAAAGCATGAGG - Intronic
1047409278 8:124611045-124611067 TGCACTGTTTCTACAGCATGTGG - Intronic
1052467655 9:28850468-28850490 TGCAATGTAACTGCAGAGAGTGG - Intergenic
1055231033 9:74065937-74065959 TTCAAGGTATCTACAGCAAATGG - Intergenic
1059386413 9:113968396-113968418 GGGAATGTATCTTCAGCTGGCGG + Intronic
1187676829 X:21724482-21724504 TGAAATATATCTATAGATAGAGG + Intronic
1190552327 X:51597681-51597703 TGCAATGTATCAAAAAGTAGTGG - Intergenic
1194446052 X:93987865-93987887 TGCAATGCCTCTCCAGCAAGGGG + Intergenic
1196535890 X:116843891-116843913 TTCAATGTATTTTCAGTTAGAGG + Intergenic