ID: 1111398077

View in Genome Browser
Species Human (GRCh38)
Location 13:87694159-87694181
Sequence CATAATTATTACTATGAGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111398077 Original CRISPR CATAATTATTACTATGAGCT TGG Exonic
901775287 1:11556342-11556364 CATAAATTTAACTATGAGATGGG - Intergenic
902338742 1:15768733-15768755 CATCATTGTTAACATGAGCTGGG - Intronic
904215000 1:28912548-28912570 CATAGATCTTACTATGAGCTAGG + Intronic
907893591 1:58661707-58661729 CATTATTATTATTAATAGCTTGG - Intronic
909362795 1:74783645-74783667 CTTAGTTCTTACTATGTGCTAGG - Intergenic
910089632 1:83446911-83446933 CACAAATAATACTATGAGATAGG + Intergenic
910644961 1:89504572-89504594 GACAATTATTATTATGAGGTAGG + Intergenic
910818826 1:91323490-91323512 CTTATTTATTACTATGTGATAGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
917398778 1:174622978-174623000 CATAACTATTAAAATGATCTTGG - Intronic
918007017 1:180550599-180550621 CATAATTGTTAATATGAGGTTGG - Intergenic
918014111 1:180616340-180616362 CATAATGCTTACTGTGAACTGGG - Intergenic
918754598 1:188323011-188323033 CATATTTATTTCCATGAGTTTGG + Intergenic
918995361 1:191752133-191752155 CATAAATCTTACTATCGGCTGGG - Intergenic
919716094 1:200778273-200778295 CAGAATTATTACTAAGAGAGTGG + Intronic
919864796 1:201772730-201772752 CATTATAAATACTAGGAGCTTGG + Intronic
921835274 1:219772078-219772100 AATATTTATTACTCTAAGCTTGG + Intronic
923501143 1:234565776-234565798 TATAATCATTACTTTGTGCTTGG + Intergenic
924254413 1:242168442-242168464 CTTACTTATTACTATAAACTTGG - Intronic
1063510800 10:6643402-6643424 TATTATTATTATTATGAGATAGG + Intergenic
1064219067 10:13424358-13424380 TATAATTATTACTATGAGACTGG - Intergenic
1064358340 10:14640091-14640113 CTGAATAATTCCTATGAGCTGGG + Intronic
1065670578 10:28112732-28112754 CATGATTATTACTATGTGGAAGG + Intronic
1068307665 10:55234801-55234823 CCTAATTATTACAATGAGAGTGG + Intronic
1068746627 10:60539381-60539403 AATAATTAATCCTAGGAGCTAGG + Intronic
1069197244 10:65568004-65568026 CATAATTTTTAGTTTGGGCTGGG - Intergenic
1069492964 10:68877273-68877295 CATAATTCCTACTATGACATGGG - Intronic
1070126855 10:73629464-73629486 CATCAGTATTCCTAGGAGCTTGG - Intergenic
1070670227 10:78372559-78372581 CATGACTAATAATATGAGCTGGG + Intergenic
1072473247 10:95733834-95733856 CATAATTTTGACAATGAGCCAGG - Intronic
1073450459 10:103606213-103606235 CATCATCATTACTCTGAGATAGG + Intronic
1074031426 10:109692668-109692690 AATAGTTATTACTATGAACCAGG - Intergenic
1074131743 10:110585273-110585295 AAAAATTGTTACTATCAGCTGGG - Intronic
1074268381 10:111928128-111928150 CATAATGCTTACTTTGTGCTAGG + Intergenic
1074273412 10:111977546-111977568 CATAATTAAAACTATGAGATTGG + Intergenic
1075000218 10:118791379-118791401 CATTATTATTACTATTATTTGGG - Intergenic
1075931647 10:126301884-126301906 CATAATTTATACTCTGAGCCTGG + Intronic
1079432693 11:20409434-20409456 CAAAATATTTACTATGTGCTGGG - Intronic
1079507810 11:21173906-21173928 CATAATTATTATTATCATTTAGG - Intronic
1081590498 11:44419608-44419630 TAGAGTTATTACTATGTGCTAGG + Intergenic
1085118455 11:73951076-73951098 CAGGATTATTACTCTGTGCTCGG + Exonic
1086255192 11:84867619-84867641 TATTATTATTACTCTGTGCTTGG - Intronic
1091090296 11:132764613-132764635 CTGAATTCTTACTATGTGCTGGG - Intronic
1091909351 12:4216256-4216278 TATTATTATTACTATTTGCTAGG - Intergenic
1095593423 12:43932107-43932129 CTTAATTCTAACTATGAGCCTGG - Intronic
1096888033 12:54736931-54736953 TAAAATTATTACTAAGGGCTGGG - Intergenic
1097720400 12:63013699-63013721 AATGAATATTACTATGAACTTGG + Intergenic
1097720410 12:63013810-63013832 CATAATATTTACTATGTGCCAGG + Intergenic
1098498869 12:71167074-71167096 TATAATCATCACTATGTGCTGGG + Intronic
1099109426 12:78538937-78538959 CAGAAATATTACTATGATCACGG + Intergenic
1099654780 12:85475749-85475771 CAGAATAAATACTATAAGCTAGG - Intergenic
1100888392 12:99098164-99098186 CATAAAGATTACTAGGAACTTGG + Intronic
1102912357 12:116726739-116726761 CATAAAGATTATTAAGAGCTTGG + Intronic
1103319593 12:120083946-120083968 TATAAATATTACTATTGGCTGGG - Intronic
1103390033 12:120565712-120565734 CTTAATCCTTACTATGTGCTAGG - Intronic
1103971527 12:124675687-124675709 CATAATTATGACAATGACCTTGG + Intergenic
1106745972 13:32707775-32707797 TATTATTTTTACTATGAGCTAGG - Intronic
1107330328 13:39292824-39292846 AATAATTATTATTATTATCTGGG + Intergenic
1110077908 13:71273195-71273217 CAGAATTAATCCTATGTGCTAGG + Intergenic
1110467843 13:75823428-75823450 CATAACTATTGCTAAAAGCTTGG - Intronic
1110998414 13:82143364-82143386 CAAAATAATTACTATGGTCTCGG - Intergenic
1111026338 13:82531495-82531517 CAAAATTATTACACTGAACTTGG - Intergenic
1111159216 13:84371443-84371465 CACAATTATTAAAATTAGCTAGG + Intergenic
1111398077 13:87694159-87694181 CATAATTATTACTATGAGCTTGG + Exonic
1112475269 13:99726283-99726305 GATAATTATGACAATGAGCCTGG - Intronic
1113085236 13:106563272-106563294 CATAATTATTCCTATGCAGTGGG + Intronic
1115657072 14:35453551-35453573 AATAATTATTATTATGAGACAGG + Intergenic
1117365221 14:55020574-55020596 AATATTTATTACTGTGAACTTGG - Intronic
1118261035 14:64246803-64246825 CATAATCATCAGTATAAGCTGGG + Intronic
1120052490 14:79883335-79883357 CATAAATATTCTTGTGAGCTAGG + Intergenic
1120240540 14:81944722-81944744 AATAAATATTACCATGTGCTAGG - Intergenic
1121199806 14:92107369-92107391 CATAAGGCTTTCTATGAGCTAGG + Intergenic
1122914686 14:104853027-104853049 AATAAATATTTCTATGAGCTGGG - Intergenic
1123955802 15:25333158-25333180 GTTAATTATTACTTTGAGCCAGG + Intergenic
1125547154 15:40514140-40514162 CAAAATAATTACTATTGGCTGGG + Intergenic
1125650539 15:41313974-41313996 CGTAATTATTCATATGAGCCTGG - Intronic
1126857441 15:52852776-52852798 AATAATTATCAGTATGATCTTGG + Intergenic
1127658700 15:61080011-61080033 CATAATCCTTACTGTGTGCTGGG - Intronic
1127835384 15:62786904-62786926 CATTATTATTATTTTGAGCCGGG + Intronic
1129417476 15:75394260-75394282 TATAAATAGTACTAGGAGCTAGG - Intronic
1133508481 16:6434860-6434882 CTGAGTTATTACTATGTGCTAGG + Intronic
1134321213 16:13166019-13166041 AATAACTATTACTATGAGGATGG - Intronic
1134477135 16:14584299-14584321 AATAATTATTACAAAGAGTTTGG + Intronic
1134658721 16:15967598-15967620 TATTATTATTATTATTAGCTGGG + Intronic
1136929155 16:34403456-34403478 TATAATTATTACCATGAGCCAGG + Intergenic
1136975419 16:35008348-35008370 TATAATTATTACCATGAGCCAGG - Intergenic
1137035570 16:35566835-35566857 CATCATTTTTCCTGTGAGCTGGG + Intergenic
1139234923 16:65327735-65327757 CAGAATTATTTCTAGGAGATGGG - Intergenic
1140896878 16:79332592-79332614 CATAATTATTATTGTGAGTCAGG - Intergenic
1141412956 16:83848206-83848228 CAAAATTATAATTAAGAGCTGGG + Intergenic
1142064719 16:88054722-88054744 CATAAATATTCCTATGAGCTAGG - Intronic
1142733042 17:1875388-1875410 CACCATTATTACTTTGACCTCGG + Intronic
1142954287 17:3510703-3510725 CATATTTTTTACTGTGATCTTGG - Intronic
1144002327 17:11066905-11066927 TATGTTTATTACTAAGAGCTTGG - Intergenic
1144060449 17:11579462-11579484 CTGAATTCTTACTATGCGCTTGG - Intergenic
1146921035 17:36711873-36711895 GATGATTATAACTATGGGCTGGG + Intergenic
1149593415 17:57848779-57848801 CATAATGATCACCATAAGCTTGG + Intronic
1149926682 17:60708517-60708539 AATTATTATTATTATTAGCTGGG - Intronic
1150416166 17:64990497-64990519 CATCATTGTCTCTATGAGCTTGG - Intergenic
1150795506 17:68233640-68233662 CATCATTCTCTCTATGAGCTTGG + Intergenic
1150933139 17:69606885-69606907 CATAAGAATTATTTTGAGCTGGG - Intergenic
1153793455 18:8600893-8600915 TATTATTATTACTTTGAGATGGG + Intergenic
1156366560 18:36432960-36432982 CATAATCATTTCTATGACCCCGG + Intronic
1158205398 18:54987138-54987160 ACTAATTAGTAGTATGAGCTTGG - Intergenic
1158548975 18:58418842-58418864 CATTATTATTATTATTATCTAGG - Intergenic
1158979823 18:62749153-62749175 CATAATTATTATTATTTGGTCGG + Intronic
1158991965 18:62878194-62878216 TATACTTATTACTATGCACTAGG - Intronic
1159068805 18:63599426-63599448 AATATTTATTTCTATGAGTTGGG - Intronic
1163261651 19:16194276-16194298 CATTATTATTATTTTGAGATGGG + Intergenic
1163505404 19:17702970-17702992 CATTATTATTATTTTGAGATGGG - Intergenic
1164180902 19:22817688-22817710 CATAATCATACCTATGAGCTGGG - Intergenic
1168632778 19:57970545-57970567 CACAATTCTTACTATGAGTAAGG + Intronic
925990102 2:9247933-9247955 CATAATTATGCCTGAGAGCTGGG - Intronic
927324902 2:21793320-21793342 TATTATTATTACAATGTGCTTGG - Intergenic
930061611 2:47294318-47294340 GCTAATTATTAATATTAGCTTGG + Intergenic
931101232 2:59003316-59003338 CATAACTCTTACTATGCTCTTGG - Intergenic
931361260 2:61579780-61579802 CATTATTATCATTATGTGCTTGG - Intergenic
931681764 2:64755579-64755601 CATGCTTATTACAGTGAGCTAGG + Intergenic
934175531 2:89575908-89575930 CATAATAAATAATATAAGCTGGG - Intergenic
934285847 2:91650272-91650294 CATAATAAATAATATAAGCTGGG - Intergenic
935364395 2:102274279-102274301 CATAATTATTCTTATTAGATAGG - Intergenic
937528275 2:122797495-122797517 CACAGTTTTTACTCTGAGCTTGG + Intergenic
938755939 2:134378960-134378982 CATAATCATTACTATGTGCCAGG - Intronic
939077344 2:137619861-137619883 TATAATCATTAATATTAGCTTGG + Intronic
939479167 2:142727404-142727426 TATAATTATTATTTTCAGCTTGG + Intergenic
939582263 2:143964723-143964745 AATGGTTATTACTATGATCTTGG - Intronic
939944353 2:148390854-148390876 AACAATTATTACTATAGGCTGGG - Intronic
940520524 2:154740066-154740088 TATAATTACTACTATTACCTGGG - Intronic
941140767 2:161778294-161778316 GATAATTATTATTATTATCTGGG - Intronic
941692050 2:168510743-168510765 CATTATCATTACTATCATCTTGG + Intronic
942166153 2:173242998-173243020 TAAAATTATTACTCTGGGCTGGG - Intronic
942220951 2:173768449-173768471 AATAATTATTATTATTGGCTGGG + Intergenic
942404404 2:175638254-175638276 CAAAATTACTACCATGATCTAGG - Intergenic
942579728 2:177404949-177404971 TATAAGTATTAATCTGAGCTAGG + Intronic
943748344 2:191485654-191485676 TATTATTATTACTATGAGGTGGG - Intergenic
944469567 2:200038374-200038396 TATTATTATTATTATTAGCTAGG + Intergenic
945509589 2:210684340-210684362 CATACTTAATACTATGGGCATGG - Intergenic
946083482 2:217148348-217148370 CATTATTATTATTATGAGACAGG + Intergenic
947098907 2:226597597-226597619 CATAATAACTACTATGAACAAGG + Intergenic
948877076 2:240835281-240835303 CAAAATCATTACTCTGTGCTTGG + Intergenic
1169102826 20:2966616-2966638 CATAGTTATTACTGTGTGCTAGG + Intronic
1169464927 20:5828876-5828898 CATTATTATTATTTTGAGATAGG + Intronic
1169493142 20:6088147-6088169 CACAATTTTTTCTATGAGTTTGG - Intronic
1169715385 20:8610902-8610924 CATCATTATCATAATGAGCTTGG - Intronic
1170045655 20:12082739-12082761 CACATTTATTCCTATGACCTGGG + Intergenic
1174636268 20:52002412-52002434 TATTATTATTATTATTAGCTGGG + Intergenic
1177006821 21:15683720-15683742 CATAATTATTAATATATGCTTGG - Intergenic
1177677601 21:24322033-24322055 CATAATTATTATTCTTGGCTGGG + Intergenic
1180136381 21:45864815-45864837 CATATTTATTTCTATGAACTTGG - Intronic
1182273471 22:29170379-29170401 TATTATTATTACTGTGAGATGGG - Intergenic
1182785378 22:32903282-32903304 CATAATGTTTACTATGTGCCAGG - Intronic
1184542468 22:45136343-45136365 TATAATTCTTACTCTGAGCAGGG + Intergenic
949725185 3:7035820-7035842 CATAATTATTTCTAAGACATGGG - Intronic
950943714 3:16922701-16922723 TATTTTTATTACTATGGGCTAGG - Intronic
951509795 3:23487555-23487577 CATAGCCATTACTATGAGCCAGG + Intronic
951536664 3:23746332-23746354 CATTATTATTATTATTAGCTGGG - Intergenic
951850474 3:27133983-27134005 AATAATTATGACTATTTGCTGGG - Intronic
952067570 3:29590340-29590362 CTAAATTCTTACTATGATCTAGG - Intronic
954454355 3:50589436-50589458 AATAATTAAAAATATGAGCTGGG + Intergenic
955678433 3:61474309-61474331 CCTAATTATTAATATTAGGTTGG + Intergenic
956221838 3:66912770-66912792 CATAATTTTTTCTATAAACTAGG - Intergenic
956882481 3:73525251-73525273 CAAAATTATAACTATGAGCAAGG - Intronic
957980492 3:87503368-87503390 CATAATTCTAACTTTAAGCTGGG + Intergenic
958616308 3:96497159-96497181 TTTAATTAGAACTATGAGCTCGG - Intergenic
958654708 3:96985410-96985432 CATATTTTTTACTATTATCTTGG + Intronic
959551806 3:107668467-107668489 CAGTATTATTTCTATGAGCCCGG + Intronic
959742799 3:109739768-109739790 AGAAATTATTACTATTAGCTAGG - Intergenic
960170734 3:114457603-114457625 CATCATTATTATTATGAGCCAGG - Intronic
960337154 3:116432231-116432253 CATGAATATTACTTTGAACTTGG - Intronic
960567300 3:119147161-119147183 GATCAGCATTACTATGAGCTTGG - Exonic
961842376 3:129726251-129726273 AATAATTCTTACTATGTGCCAGG + Intronic
963192332 3:142486818-142486840 AATAATTATTATTATTGGCTGGG + Intronic
964184675 3:153928594-153928616 CCTAGTTATTACTGTGAGATAGG + Intergenic
964830328 3:160877446-160877468 CAAAATTATTTCTATGAGCTGGG - Intronic
965168361 3:165226314-165226336 CATAGGCATTACTATGTGCTAGG - Intergenic
966806631 3:183812818-183812840 CATAATTATTCCTGACAGCTTGG + Intergenic
972262852 4:37428045-37428067 TTTAATCATTTCTATGAGCTAGG + Intronic
972554041 4:40163202-40163224 CATTATGTTTACTATGAACTAGG + Intergenic
972812258 4:42603017-42603039 GATAATTACTAATATGAGATAGG - Intronic
974155706 4:58069476-58069498 CATAATAATTAACATGAACTAGG + Intergenic
976020785 4:80622925-80622947 TATATTTGTAACTATGAGCTTGG + Intronic
980504788 4:133703738-133703760 AATAATTATTATAATGAGTTTGG + Intergenic
981306131 4:143248670-143248692 CTTAATTGTTACTTTCAGCTTGG - Intergenic
981815757 4:148829325-148829347 AATAATTATTACTATGTGCAGGG - Intergenic
984721445 4:182976929-182976951 CATTATTATTATTAACAGCTTGG - Intergenic
985340722 4:188950485-188950507 TATTATTATTATTATGAGATAGG + Intergenic
989378660 5:40792335-40792357 CATAACTATTACTATTAGAAAGG + Intronic
990248152 5:53884218-53884240 CATAAATATTACAAGAAGCTAGG + Intronic
990347943 5:54887445-54887467 CAGAATTCTTACCATGAGCCAGG - Intergenic
990415244 5:55580004-55580026 CATTATTATTATTTTGAGATAGG + Intergenic
991158832 5:63470546-63470568 CATATTTATTTATATGAGATAGG - Intergenic
993618920 5:90145640-90145662 AATAATTATTACATTGAGGTGGG + Intergenic
994705757 5:103204603-103204625 AAAAATTATTCCCATGAGCTGGG - Intronic
994927033 5:106129003-106129025 TATTATTATTACTTTGAGATAGG - Intergenic
995432975 5:112102742-112102764 CCTACATATTTCTATGAGCTTGG - Intergenic
995698620 5:114907378-114907400 CATAGTTAGTAGTATGAACTGGG - Intergenic
995878725 5:116820196-116820218 ATTAATAATTACTATGAGCCAGG - Intergenic
999576280 5:152981579-152981601 CATAATTATTTAAATGAGCTTGG - Intergenic
999776669 5:154817377-154817399 CATTATCTTTACTATGTGCTAGG + Exonic
1000115632 5:158150920-158150942 AATAATTCTTACAATGTGCTGGG + Intergenic
1004456958 6:15800235-15800257 CATAATTCTTACAATGTCCTAGG + Intergenic
1004680632 6:17890785-17890807 TATTATTATTATTATTAGCTGGG - Intronic
1005767442 6:29026873-29026895 CAGAATTACTACTGTGAGGTGGG + Intergenic
1008525229 6:52400898-52400920 CATTTTTATTGCTATGAGCTGGG - Intronic
1009766816 6:68088024-68088046 TAGGATTATTACAATGAGCTTGG - Intergenic
1013032138 6:106344026-106344048 CATAATAATAACTATTGGCTGGG + Intergenic
1013769436 6:113611122-113611144 CATATTTATTACAATGCTCTTGG + Intergenic
1018584918 6:165346895-165346917 CTTAATTATTACTGTGAGAGTGG + Intronic
1020221476 7:6241958-6241980 AATAATTATTTCTAAGAGGTAGG + Intronic
1020372655 7:7451019-7451041 CATAATCATTATTATGAATTTGG - Intronic
1021534764 7:21690810-21690832 AATATTTATTACTATGAACCCGG + Exonic
1021658734 7:22897587-22897609 CACTGTTATTACTATGTGCTAGG - Intergenic
1022118568 7:27284708-27284730 CTTAATTATTACTAGTAGGTTGG - Intergenic
1025152071 7:56564572-56564594 AATAATGATTACTATAGGCTAGG - Intergenic
1025173238 7:56780557-56780579 GATAATGCTTACTATGTGCTAGG - Intergenic
1025698865 7:63797624-63797646 GATAATGCTTACTATGTGCTAGG + Intergenic
1025720118 7:64002174-64002196 CATAAATAGTACAAGGAGCTGGG - Intergenic
1025759530 7:64377234-64377256 CATTATTATGCCTATGAGCTGGG - Intergenic
1025765114 7:64438057-64438079 AATAATAATTACTACGGGCTAGG + Intergenic
1025917733 7:65879430-65879452 GATAATGCTTACTATGTGCTAGG + Intronic
1027306492 7:76903348-76903370 CACAAATAATACTATGAGATAGG + Intergenic
1028087034 7:86648466-86648488 CATAATTAATAGAATGTGCTAGG + Intronic
1029408319 7:100391193-100391215 TATTATTATTATTATTAGCTGGG + Intronic
1030584451 7:111400199-111400221 CAGACTGCTTACTATGAGCTAGG - Intronic
1031840468 7:126731694-126731716 CACAATTATTACAATGATCATGG + Intronic
1031898119 7:127377616-127377638 GTTAATCATTACAATGAGCTGGG + Intronic
1032757084 7:134901453-134901475 AATAATTATTGCCATGAACTGGG + Intronic
1036673886 8:10813028-10813050 CAAAATGATCACTGTGAGCTGGG - Intronic
1038716386 8:29994771-29994793 AATAAATATTTCTATGACCTTGG - Intergenic
1039910638 8:41824296-41824318 TATAATTATTATTATGACTTTGG + Intronic
1040358681 8:46644227-46644249 CACTATTATGCCTATGAGCTGGG - Intergenic
1040382279 8:46884558-46884580 CATTATTATGCCTGTGAGCTGGG + Intergenic
1041322492 8:56628045-56628067 CACAATTTTTATCATGAGCTTGG - Intergenic
1041510510 8:58650014-58650036 CAGAATTATTTCAATGATCTAGG - Intronic
1041974291 8:63779219-63779241 CAGAATTATTACTTTGATTTGGG + Intergenic
1042371544 8:67997187-67997209 CTGAATTATTACTATTAGGTTGG - Intronic
1042554107 8:70019877-70019899 TAAAATTATTATTATTAGCTGGG - Intergenic
1043251862 8:78084895-78084917 TATAATTATTACCCTGATCTAGG + Intergenic
1043612409 8:82081208-82081230 CATAATAATAACTTTGAGGTAGG + Intergenic
1044848457 8:96405018-96405040 CACAATTATTCTTATGAGGTAGG + Intergenic
1045671847 8:104563955-104563977 CATAGTAGTTACTATGAGCCAGG - Intronic
1045785229 8:105913139-105913161 TATAATTATCACTGAGAGCTTGG + Intergenic
1047335157 8:123928966-123928988 AATAGGTATTATTATGAGCTTGG + Intronic
1048383157 8:133886151-133886173 AAAAATCACTACTATGAGCTAGG - Intergenic
1050537096 9:6640261-6640283 AATAATAATTCCTATAAGCTGGG + Intronic
1051598734 9:18850897-18850919 TATAATTAGTTCTGTGAGCTGGG - Intronic
1052019970 9:23514440-23514462 CATAATACCTACTCTGAGCTGGG - Intergenic
1055264874 9:74483190-74483212 AATTATTATTATTATTAGCTGGG + Intergenic
1056846524 9:90042690-90042712 TATAAATATAACAATGAGCTGGG + Intergenic
1058914644 9:109554047-109554069 GAATATTATTAATATGAGCTAGG - Intergenic
1058940851 9:109811522-109811544 GATAATTATTACTATTATATAGG - Intronic
1059896922 9:118876719-118876741 AAAAAAAATTACTATGAGCTGGG - Intergenic
1060957473 9:127653138-127653160 TATTATTATTATTATGAGATGGG + Intronic
1061029739 9:128073700-128073722 GATAATTATGACTTTGAGCCAGG - Intronic
1186436081 X:9544154-9544176 CATAATAATTAGTAGGAGTTTGG - Intronic
1186845718 X:13529056-13529078 CATAATTATCATCATCAGCTTGG - Intergenic
1187408253 X:19023858-19023880 TATAATTATTGTTATGACCTGGG - Intronic
1189092027 X:38093688-38093710 AATAACTATTCCTGTGAGCTTGG + Intronic
1189196709 X:39159673-39159695 CATGATAATTTCTGTGAGCTGGG - Intergenic
1189699025 X:43696981-43697003 CATTATTATTACTATGGGAGCGG - Intronic
1193145308 X:78069775-78069797 CATAGTTCTTACTTTGTGCTAGG + Intronic
1193257186 X:79363405-79363427 TATAATTATTATTATTACCTTGG + Exonic
1194499887 X:94668936-94668958 CATTATTATTACTTTGAGATGGG - Intergenic
1194584578 X:95717001-95717023 CACAATTATTACCATGAGGGTGG + Intergenic
1194777532 X:97983158-97983180 AATAATTATTAATAGGAGTTAGG - Intergenic
1194919946 X:99752704-99752726 TATAATTATTACTATTATCAAGG + Intergenic
1197019001 X:121663713-121663735 GATAATAATTACTATGTGCCAGG + Intergenic
1197026195 X:121752482-121752504 CATAATTATTATTATAAAATAGG - Intergenic
1197224887 X:123947005-123947027 CTTAATTATTAATATGACCTTGG + Intergenic
1197325167 X:125083917-125083939 CATAATTTTTACTAGGAGGGTGG + Intergenic
1197538010 X:127715018-127715040 CATAATTGTTACTAGAATCTGGG + Intergenic
1197885431 X:131212837-131212859 CATACTAATTACTGTGGGCTGGG + Intergenic
1198883302 X:141305622-141305644 CATAATGATTATTATGAATTTGG - Intergenic
1199053331 X:143263102-143263124 CATAACTATTACTATTGCCTAGG + Intergenic
1200844067 Y:7813577-7813599 CATTATTATGCCTATGATCTGGG + Intergenic
1200856838 Y:7948048-7948070 CATTATTATGCCTGTGAGCTGGG + Intergenic
1200865887 Y:8042922-8042944 CATAATTCTTACTGAGAGCAGGG - Intergenic
1200870312 Y:8090959-8090981 CATTATTATGCCTATGATCTGGG + Intergenic
1200894382 Y:8359265-8359287 CATTATTATGCCTGTGAGCTGGG + Intergenic
1200900225 Y:8424075-8424097 CATTATTATTTCTGTGGGCTGGG + Intergenic
1200907622 Y:8500627-8500649 TATTATTATGCCTATGAGCTGGG - Intergenic
1202244790 Y:22809139-22809161 TATTTTTATTTCTATGAGCTGGG - Intergenic
1202251388 Y:22877190-22877212 CATTATTATTCCTGTGGGCTGGG + Intergenic
1202268265 Y:23043811-23043833 GATAATTCTTACTGTCAGCTGGG - Intergenic
1202397779 Y:24442885-24442907 TATTTTTATTTCTATGAGCTGGG - Intergenic
1202404376 Y:24510939-24510961 CATTATTATTCCTGTGGGCTGGG + Intergenic
1202421257 Y:24677555-24677577 GATAATTCTTACTGTCAGCTGGG - Intergenic
1202449529 Y:24992527-24992549 GATAATTCTTACTGTCAGCTGGG + Intergenic
1202466403 Y:25159143-25159165 CATTATTATTCCTGTGGGCTGGG - Intergenic
1202473002 Y:25227202-25227224 TATTTTTATTTCTATGAGCTGGG + Intergenic
1202603237 Y:26615650-26615672 CATAATCATCAATGTGAGCTGGG + Intergenic