ID: 1111405498

View in Genome Browser
Species Human (GRCh38)
Location 13:87799089-87799111
Sequence AGAGGGTCCCAGAACTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111405498_1111405502 27 Left 1111405498 13:87799089-87799111 CCTTGAAAGTTCTGGGACCCTCT No data
Right 1111405502 13:87799139-87799161 GCCTTAGAGTCTCATTGAGAAGG No data
1111405498_1111405499 -9 Left 1111405498 13:87799089-87799111 CCTTGAAAGTTCTGGGACCCTCT No data
Right 1111405499 13:87799103-87799125 GGACCCTCTCTGTGTTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111405498 Original CRISPR AGAGGGTCCCAGAACTTTCA AGG (reversed) Intergenic
No off target data available for this crispr