ID: 1111409341

View in Genome Browser
Species Human (GRCh38)
Location 13:87854035-87854057
Sequence GTTCCCATTCAGATTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111409341_1111409347 -5 Left 1111409341 13:87854035-87854057 CCTTCCACAATCTGAATGGGAAC No data
Right 1111409347 13:87854053-87854075 GGAACCACAGGGAGAAAGGAGGG No data
1111409341_1111409349 5 Left 1111409341 13:87854035-87854057 CCTTCCACAATCTGAATGGGAAC No data
Right 1111409349 13:87854063-87854085 GGAGAAAGGAGGGCATGAGAAGG No data
1111409341_1111409346 -6 Left 1111409341 13:87854035-87854057 CCTTCCACAATCTGAATGGGAAC No data
Right 1111409346 13:87854052-87854074 GGGAACCACAGGGAGAAAGGAGG No data
1111409341_1111409345 -9 Left 1111409341 13:87854035-87854057 CCTTCCACAATCTGAATGGGAAC No data
Right 1111409345 13:87854049-87854071 AATGGGAACCACAGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111409341 Original CRISPR GTTCCCATTCAGATTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr