ID: 1111410745

View in Genome Browser
Species Human (GRCh38)
Location 13:87873488-87873510
Sequence ATCCAATCCAATATCTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111410745_1111410746 -7 Left 1111410745 13:87873488-87873510 CCAATAAAGATATTGGATTGGAT No data
Right 1111410746 13:87873504-87873526 ATTGGATTATAGATGTCAAATGG No data
1111410745_1111410747 8 Left 1111410745 13:87873488-87873510 CCAATAAAGATATTGGATTGGAT No data
Right 1111410747 13:87873519-87873541 TCAAATGGATAGAGTTGTTCAGG No data
1111410745_1111410748 24 Left 1111410745 13:87873488-87873510 CCAATAAAGATATTGGATTGGAT No data
Right 1111410748 13:87873535-87873557 GTTCAGGAGAAGAATCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111410745 Original CRISPR ATCCAATCCAATATCTTTAT TGG (reversed) Intergenic
No off target data available for this crispr