ID: 1111413376

View in Genome Browser
Species Human (GRCh38)
Location 13:87906918-87906940
Sequence AAATATCCATAGTTTAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111413374_1111413376 7 Left 1111413374 13:87906888-87906910 CCTGAAAAAAATTATGTAAAAGT No data
Right 1111413376 13:87906918-87906940 AAATATCCATAGTTTAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111413376 Original CRISPR AAATATCCATAGTTTAAGCA GGG Intergenic
No off target data available for this crispr