ID: 1111415557

View in Genome Browser
Species Human (GRCh38)
Location 13:87938993-87939015
Sequence CTGCAATTCTTGAGGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111415553_1111415557 -6 Left 1111415553 13:87938976-87938998 CCGATTTATCAAAGAGACTGCAA No data
Right 1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111415557 Original CRISPR CTGCAATTCTTGAGGGGAAA TGG Intergenic
No off target data available for this crispr