ID: 1111416324

View in Genome Browser
Species Human (GRCh38)
Location 13:87950132-87950154
Sequence TCAGATATGCACCACCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111416324_1111416326 -10 Left 1111416324 13:87950132-87950154 CCCAGCTGGTGGTGCATATCTGA No data
Right 1111416326 13:87950145-87950167 GCATATCTGATTCATGTGACAGG No data
1111416324_1111416327 -4 Left 1111416324 13:87950132-87950154 CCCAGCTGGTGGTGCATATCTGA No data
Right 1111416327 13:87950151-87950173 CTGATTCATGTGACAGGAGATGG No data
1111416324_1111416329 14 Left 1111416324 13:87950132-87950154 CCCAGCTGGTGGTGCATATCTGA No data
Right 1111416329 13:87950169-87950191 GATGGAGTGTCTGCCACTGGAGG No data
1111416324_1111416328 11 Left 1111416324 13:87950132-87950154 CCCAGCTGGTGGTGCATATCTGA No data
Right 1111416328 13:87950166-87950188 GGAGATGGAGTGTCTGCCACTGG No data
1111416324_1111416331 30 Left 1111416324 13:87950132-87950154 CCCAGCTGGTGGTGCATATCTGA No data
Right 1111416331 13:87950185-87950207 CTGGAGGATTCATTTCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111416324 Original CRISPR TCAGATATGCACCACCAGCT GGG (reversed) Intergenic
No off target data available for this crispr