ID: 1111416354

View in Genome Browser
Species Human (GRCh38)
Location 13:87950397-87950419
Sequence CAGTATCACTTTAAATGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111416354_1111416357 8 Left 1111416354 13:87950397-87950419 CCAGGTCATTTAAAGTGATACTG No data
Right 1111416357 13:87950428-87950450 TCTCTTCTGAAATACTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111416354 Original CRISPR CAGTATCACTTTAAATGACC TGG (reversed) Intergenic
No off target data available for this crispr