ID: 1111420537

View in Genome Browser
Species Human (GRCh38)
Location 13:88005208-88005230
Sequence CAGTGGTGCGGTAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111420530_1111420537 16 Left 1111420530 13:88005169-88005191 CCTGGGCTTCTGAGTGGCTTTCT No data
Right 1111420537 13:88005208-88005230 CAGTGGTGCGGTAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111420537 Original CRISPR CAGTGGTGCGGTAAGGAGGT GGG Intergenic
No off target data available for this crispr