ID: 1111428841

View in Genome Browser
Species Human (GRCh38)
Location 13:88125802-88125824
Sequence GGCTCCATGCTTATTGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111428839_1111428841 27 Left 1111428839 13:88125752-88125774 CCTGGATTTATGAACAGATCTTT No data
Right 1111428841 13:88125802-88125824 GGCTCCATGCTTATTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111428841 Original CRISPR GGCTCCATGCTTATTGAATC AGG Intergenic