ID: 1111431241

View in Genome Browser
Species Human (GRCh38)
Location 13:88150687-88150709
Sequence CAGGTTTGACAGAGCTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111431238_1111431241 -7 Left 1111431238 13:88150671-88150693 CCTCCCACAACGGAAACAGGTTT No data
Right 1111431241 13:88150687-88150709 CAGGTTTGACAGAGCTGATATGG No data
1111431235_1111431241 3 Left 1111431235 13:88150661-88150683 CCATTAGCTACCTCCCACAACGG No data
Right 1111431241 13:88150687-88150709 CAGGTTTGACAGAGCTGATATGG No data
1111431239_1111431241 -10 Left 1111431239 13:88150674-88150696 CCCACAACGGAAACAGGTTTGAC No data
Right 1111431241 13:88150687-88150709 CAGGTTTGACAGAGCTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111431241 Original CRISPR CAGGTTTGACAGAGCTGATA TGG Intergenic
No off target data available for this crispr