ID: 1111433772

View in Genome Browser
Species Human (GRCh38)
Location 13:88179835-88179857
Sequence TAGGGTTAGCAGACTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111433763_1111433772 18 Left 1111433763 13:88179794-88179816 CCCCAAAATGTACTTTTTGGCAT No data
Right 1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG No data
1111433764_1111433772 17 Left 1111433764 13:88179795-88179817 CCCAAAATGTACTTTTTGGCATA No data
Right 1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG No data
1111433765_1111433772 16 Left 1111433765 13:88179796-88179818 CCAAAATGTACTTTTTGGCATAT No data
Right 1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111433772 Original CRISPR TAGGGTTAGCAGACTGAGGT GGG Intergenic
No off target data available for this crispr