ID: 1111437027

View in Genome Browser
Species Human (GRCh38)
Location 13:88224487-88224509
Sequence AAAAAACAGAACTGTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111437027_1111437030 3 Left 1111437027 13:88224487-88224509 CCAGGCCCACAGTTCTGTTTTTT No data
Right 1111437030 13:88224513-88224535 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111437027 Original CRISPR AAAAAACAGAACTGTGGGCC TGG (reversed) Intergenic
No off target data available for this crispr