ID: 1111440752

View in Genome Browser
Species Human (GRCh38)
Location 13:88280604-88280626
Sequence GATGTTGCCACCACTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111440752_1111440763 17 Left 1111440752 13:88280604-88280626 CCACCCCCAGTGGTGGCAACATC No data
Right 1111440763 13:88280644-88280666 TGCCATCAGTCTATCCACCTTGG No data
1111440752_1111440765 24 Left 1111440752 13:88280604-88280626 CCACCCCCAGTGGTGGCAACATC No data
Right 1111440765 13:88280651-88280673 AGTCTATCCACCTTGGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111440752 Original CRISPR GATGTTGCCACCACTGGGGG TGG (reversed) Intergenic
No off target data available for this crispr