ID: 1111452839

View in Genome Browser
Species Human (GRCh38)
Location 13:88441491-88441513
Sequence GGTAATGTATGTAGTGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111452839_1111452840 -6 Left 1111452839 13:88441491-88441513 CCTCAAGCACTACATACATTACC No data
Right 1111452840 13:88441508-88441530 ATTACCTTAAAGCTTCTATGTGG No data
1111452839_1111452841 -5 Left 1111452839 13:88441491-88441513 CCTCAAGCACTACATACATTACC No data
Right 1111452841 13:88441509-88441531 TTACCTTAAAGCTTCTATGTGGG No data
1111452839_1111452843 4 Left 1111452839 13:88441491-88441513 CCTCAAGCACTACATACATTACC No data
Right 1111452843 13:88441518-88441540 AGCTTCTATGTGGGCCCTGATGG No data
1111452839_1111452848 30 Left 1111452839 13:88441491-88441513 CCTCAAGCACTACATACATTACC No data
Right 1111452848 13:88441544-88441566 CCCTTATCTCCTGCAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111452839 Original CRISPR GGTAATGTATGTAGTGCTTG AGG (reversed) Intergenic
No off target data available for this crispr