ID: 1111455504

View in Genome Browser
Species Human (GRCh38)
Location 13:88478218-88478240
Sequence GATCTATACAGCTCAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111455504_1111455506 8 Left 1111455504 13:88478218-88478240 CCAGGTGTTGAGCTGTATAGATC No data
Right 1111455506 13:88478249-88478271 CTCTCTTGCTTCTCCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111455504 Original CRISPR GATCTATACAGCTCAACACC TGG (reversed) Intergenic
No off target data available for this crispr