ID: 1111467527

View in Genome Browser
Species Human (GRCh38)
Location 13:88634976-88634998
Sequence TGTTCATGGTTAATTACTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111467527_1111467530 8 Left 1111467527 13:88634976-88634998 CCTATAGTAATTAACCATGAACA No data
Right 1111467530 13:88635007-88635029 AGCCCTATTAATATCATTAAGGG No data
1111467527_1111467529 7 Left 1111467527 13:88634976-88634998 CCTATAGTAATTAACCATGAACA No data
Right 1111467529 13:88635006-88635028 AAGCCCTATTAATATCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111467527 Original CRISPR TGTTCATGGTTAATTACTAT AGG (reversed) Intergenic
No off target data available for this crispr