ID: 1111468421

View in Genome Browser
Species Human (GRCh38)
Location 13:88646361-88646383
Sequence GACCTCCTAGTGGTCATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111468417_1111468421 23 Left 1111468417 13:88646315-88646337 CCTTGCAGGATAATCTGAACTTT No data
Right 1111468421 13:88646361-88646383 GACCTCCTAGTGGTCATCTCAGG No data
1111468419_1111468421 -1 Left 1111468419 13:88646339-88646361 CCAACATTGTAGGATTGATCTAG No data
Right 1111468421 13:88646361-88646383 GACCTCCTAGTGGTCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111468421 Original CRISPR GACCTCCTAGTGGTCATCTC AGG Intergenic
No off target data available for this crispr