ID: 1111468705

View in Genome Browser
Species Human (GRCh38)
Location 13:88648401-88648423
Sequence TACTTAGGAAGTCCAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111468705_1111468716 26 Left 1111468705 13:88648401-88648423 CCTTTCATTGGACTTCCTAAGTA No data
Right 1111468716 13:88648450-88648472 TCAAGGCAGTTGTCACCCGGGGG No data
1111468705_1111468709 2 Left 1111468705 13:88648401-88648423 CCTTTCATTGGACTTCCTAAGTA No data
Right 1111468709 13:88648426-88648448 TCCAATGCAATAATGGCTCCTGG No data
1111468705_1111468707 -5 Left 1111468705 13:88648401-88648423 CCTTTCATTGGACTTCCTAAGTA No data
Right 1111468707 13:88648419-88648441 AAGTACCTCCAATGCAATAATGG No data
1111468705_1111468715 25 Left 1111468705 13:88648401-88648423 CCTTTCATTGGACTTCCTAAGTA No data
Right 1111468715 13:88648449-88648471 TTCAAGGCAGTTGTCACCCGGGG No data
1111468705_1111468713 23 Left 1111468705 13:88648401-88648423 CCTTTCATTGGACTTCCTAAGTA No data
Right 1111468713 13:88648447-88648469 GGTTCAAGGCAGTTGTCACCCGG No data
1111468705_1111468711 9 Left 1111468705 13:88648401-88648423 CCTTTCATTGGACTTCCTAAGTA No data
Right 1111468711 13:88648433-88648455 CAATAATGGCTCCTGGTTCAAGG No data
1111468705_1111468714 24 Left 1111468705 13:88648401-88648423 CCTTTCATTGGACTTCCTAAGTA No data
Right 1111468714 13:88648448-88648470 GTTCAAGGCAGTTGTCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111468705 Original CRISPR TACTTAGGAAGTCCAATGAA AGG (reversed) Intergenic
No off target data available for this crispr