ID: 1111470900

View in Genome Browser
Species Human (GRCh38)
Location 13:88681086-88681108
Sequence AGTTATGTACAGATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111470896_1111470900 16 Left 1111470896 13:88681047-88681069 CCACTAGCAAACCAAAAGCTATT No data
Right 1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG No data
1111470895_1111470900 17 Left 1111470895 13:88681046-88681068 CCCACTAGCAAACCAAAAGCTAT No data
Right 1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG No data
1111470897_1111470900 5 Left 1111470897 13:88681058-88681080 CCAAAAGCTATTTATCCAAAAAA No data
Right 1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG No data
1111470898_1111470900 -10 Left 1111470898 13:88681073-88681095 CCAAAAAAAGAATAGTTATGTAC No data
Right 1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111470900 Original CRISPR AGTTATGTACAGATGATGGC AGG Intergenic
No off target data available for this crispr