ID: 1111473561

View in Genome Browser
Species Human (GRCh38)
Location 13:88718076-88718098
Sequence ACGCGGACAGGAGTTCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111473555_1111473561 24 Left 1111473555 13:88718029-88718051 CCGCAGAACGATGCGGCAGAGAA No data
Right 1111473561 13:88718076-88718098 ACGCGGACAGGAGTTCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111473561 Original CRISPR ACGCGGACAGGAGTTCCGCC AGG Intergenic