ID: 1111474346

View in Genome Browser
Species Human (GRCh38)
Location 13:88725582-88725604
Sequence TTCACTCCAGTCCACAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111474346_1111474349 10 Left 1111474346 13:88725582-88725604 CCAGTTCTGTGGACTGGAGTGAA No data
Right 1111474349 13:88725615-88725637 GCTTTTTCCAGGTCCACCCATGG 0: 3
1: 45
2: 98
3: 215
4: 526
1111474346_1111474351 20 Left 1111474346 13:88725582-88725604 CCAGTTCTGTGGACTGGAGTGAA No data
Right 1111474351 13:88725625-88725647 GGTCCACCCATGGCCACCCACGG No data
1111474346_1111474348 -1 Left 1111474346 13:88725582-88725604 CCAGTTCTGTGGACTGGAGTGAA No data
Right 1111474348 13:88725604-88725626 AAACTTATGGTGCTTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111474346 Original CRISPR TTCACTCCAGTCCACAGAAC TGG (reversed) Intergenic
No off target data available for this crispr