ID: 1111487388

View in Genome Browser
Species Human (GRCh38)
Location 13:88921523-88921545
Sequence GCCATTGAGTGCTACTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111487388_1111487389 -7 Left 1111487388 13:88921523-88921545 CCTGGAAAGTAGCACTCAATGGC No data
Right 1111487389 13:88921539-88921561 CAATGGCCTAATGAGATTCTTGG No data
1111487388_1111487390 -6 Left 1111487388 13:88921523-88921545 CCTGGAAAGTAGCACTCAATGGC No data
Right 1111487390 13:88921540-88921562 AATGGCCTAATGAGATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111487388 Original CRISPR GCCATTGAGTGCTACTTTCC AGG (reversed) Intergenic
No off target data available for this crispr