ID: 1111496831

View in Genome Browser
Species Human (GRCh38)
Location 13:89061956-89061978
Sequence ATGAATCAGCTCATTGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111496831_1111496839 18 Left 1111496831 13:89061956-89061978 CCTCAGACAATGAGCTGATTCAT No data
Right 1111496839 13:89061997-89062019 GGCTCCCTCTTAGGCCCCGGTGG No data
1111496831_1111496841 20 Left 1111496831 13:89061956-89061978 CCTCAGACAATGAGCTGATTCAT No data
Right 1111496841 13:89061999-89062021 CTCCCTCTTAGGCCCCGGTGGGG No data
1111496831_1111496833 -9 Left 1111496831 13:89061956-89061978 CCTCAGACAATGAGCTGATTCAT No data
Right 1111496833 13:89061970-89061992 CTGATTCATGGAGTGCACAGTGG No data
1111496831_1111496835 -3 Left 1111496831 13:89061956-89061978 CCTCAGACAATGAGCTGATTCAT No data
Right 1111496835 13:89061976-89061998 CATGGAGTGCACAGTGGCCTGGG No data
1111496831_1111496838 15 Left 1111496831 13:89061956-89061978 CCTCAGACAATGAGCTGATTCAT No data
Right 1111496838 13:89061994-89062016 CTGGGCTCCCTCTTAGGCCCCGG No data
1111496831_1111496834 -4 Left 1111496831 13:89061956-89061978 CCTCAGACAATGAGCTGATTCAT No data
Right 1111496834 13:89061975-89061997 TCATGGAGTGCACAGTGGCCTGG No data
1111496831_1111496840 19 Left 1111496831 13:89061956-89061978 CCTCAGACAATGAGCTGATTCAT No data
Right 1111496840 13:89061998-89062020 GCTCCCTCTTAGGCCCCGGTGGG No data
1111496831_1111496836 9 Left 1111496831 13:89061956-89061978 CCTCAGACAATGAGCTGATTCAT No data
Right 1111496836 13:89061988-89062010 AGTGGCCTGGGCTCCCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111496831 Original CRISPR ATGAATCAGCTCATTGTCTG AGG (reversed) Intergenic