ID: 1111496840

View in Genome Browser
Species Human (GRCh38)
Location 13:89061998-89062020
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111496831_1111496840 19 Left 1111496831 13:89061956-89061978 CCTCAGACAATGAGCTGATTCAT No data
Right 1111496840 13:89061998-89062020 GCTCCCTCTTAGGCCCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111496840 Original CRISPR GCTCCCTCTTAGGCCCCGGT GGG Intergenic
No off target data available for this crispr