ID: 1111497545

View in Genome Browser
Species Human (GRCh38)
Location 13:89071669-89071691
Sequence ACGTAGTAACTGAGTGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111497543_1111497545 -10 Left 1111497543 13:89071656-89071678 CCTGGCAACTTACACGTAGTAAC No data
Right 1111497545 13:89071669-89071691 ACGTAGTAACTGAGTGAAAAGGG No data
1111497542_1111497545 -9 Left 1111497542 13:89071655-89071677 CCCTGGCAACTTACACGTAGTAA No data
Right 1111497545 13:89071669-89071691 ACGTAGTAACTGAGTGAAAAGGG No data
1111497540_1111497545 12 Left 1111497540 13:89071634-89071656 CCTTGCTGCACATCACAATTTCC No data
Right 1111497545 13:89071669-89071691 ACGTAGTAACTGAGTGAAAAGGG No data
1111497539_1111497545 15 Left 1111497539 13:89071631-89071653 CCACCTTGCTGCACATCACAATT No data
Right 1111497545 13:89071669-89071691 ACGTAGTAACTGAGTGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111497545 Original CRISPR ACGTAGTAACTGAGTGAAAA GGG Intergenic
No off target data available for this crispr