ID: 1111498683

View in Genome Browser
Species Human (GRCh38)
Location 13:89088240-89088262
Sequence CAGCGAGAGTCCGTGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111498683_1111498687 16 Left 1111498683 13:89088240-89088262 CCTACGCCCACGGACTCTCGCTG No data
Right 1111498687 13:89088279-89088301 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
1111498683_1111498690 30 Left 1111498683 13:89088240-89088262 CCTACGCCCACGGACTCTCGCTG No data
Right 1111498690 13:89088293-89088315 GCAAGGCGGCAGCCAGACTGGGG No data
1111498683_1111498689 29 Left 1111498683 13:89088240-89088262 CCTACGCCCACGGACTCTCGCTG No data
Right 1111498689 13:89088292-89088314 TGCAAGGCGGCAGCCAGACTGGG No data
1111498683_1111498688 28 Left 1111498683 13:89088240-89088262 CCTACGCCCACGGACTCTCGCTG No data
Right 1111498688 13:89088291-89088313 CTGCAAGGCGGCAGCCAGACTGG No data
1111498683_1111498686 13 Left 1111498683 13:89088240-89088262 CCTACGCCCACGGACTCTCGCTG No data
Right 1111498686 13:89088276-89088298 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111498683 Original CRISPR CAGCGAGAGTCCGTGGGCGT AGG (reversed) Intergenic
No off target data available for this crispr