ID: 1111500151

View in Genome Browser
Species Human (GRCh38)
Location 13:89108176-89108198
Sequence GTGGGAGCCAAGAAAAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111500151_1111500154 -4 Left 1111500151 13:89108176-89108198 CCATCATTTTTCTTGGCTCCCAC No data
Right 1111500154 13:89108195-89108217 CCACTATGACACTTCCATATAGG No data
1111500151_1111500156 14 Left 1111500151 13:89108176-89108198 CCATCATTTTTCTTGGCTCCCAC No data
Right 1111500156 13:89108213-89108235 ATAGGTAATGCCAGAACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111500151 Original CRISPR GTGGGAGCCAAGAAAAATGA TGG (reversed) Intergenic
No off target data available for this crispr