ID: 1111502063

View in Genome Browser
Species Human (GRCh38)
Location 13:89134385-89134407
Sequence CTGGGCAGTTATGGTGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111502055_1111502063 25 Left 1111502055 13:89134337-89134359 CCCAGTGAGGATTACCACAGGAC No data
Right 1111502063 13:89134385-89134407 CTGGGCAGTTATGGTGATGTTGG No data
1111502056_1111502063 24 Left 1111502056 13:89134338-89134360 CCAGTGAGGATTACCACAGGACT No data
Right 1111502063 13:89134385-89134407 CTGGGCAGTTATGGTGATGTTGG No data
1111502059_1111502063 -4 Left 1111502059 13:89134366-89134388 CCACAAGCTGCAGTCATTACTGG No data
Right 1111502063 13:89134385-89134407 CTGGGCAGTTATGGTGATGTTGG No data
1111502058_1111502063 11 Left 1111502058 13:89134351-89134373 CCACAGGACTTGGAGCCACAAGC No data
Right 1111502063 13:89134385-89134407 CTGGGCAGTTATGGTGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111502063 Original CRISPR CTGGGCAGTTATGGTGATGT TGG Intergenic
No off target data available for this crispr