ID: 1111508128

View in Genome Browser
Species Human (GRCh38)
Location 13:89222085-89222107
Sequence ACAACAGTGTTATTTTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111508126_1111508128 27 Left 1111508126 13:89222035-89222057 CCATAATGCAAAAATCTGAAAAA No data
Right 1111508128 13:89222085-89222107 ACAACAGTGTTATTTTCTACAGG No data
1111508127_1111508128 -7 Left 1111508127 13:89222069-89222091 CCAATCTTAAGTTCTGACAACAG No data
Right 1111508128 13:89222085-89222107 ACAACAGTGTTATTTTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111508128 Original CRISPR ACAACAGTGTTATTTTCTAC AGG Intergenic
No off target data available for this crispr