ID: 1111508886

View in Genome Browser
Species Human (GRCh38)
Location 13:89233754-89233776
Sequence GGACAGGTGAAGGCAAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111508886_1111508893 25 Left 1111508886 13:89233754-89233776 CCAGAATTTGCCTTCACCTGTCC No data
Right 1111508893 13:89233802-89233824 TATTTAGCTAGTCACTATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111508886 Original CRISPR GGACAGGTGAAGGCAAATTC TGG (reversed) Intergenic
No off target data available for this crispr